Frequently asked questions

Q1: Is there any logic about the numbering system for these vectors ? Some start with the letter "w", some others look like random numbers !

A: These vectors were developed either at the Lawrence Berkeley National Laboratory (Berkeley, CA) or at the University of Massachusetts Medical School (Worcester, MA). The plasmids number starting with "w" were made in Worcester whereas the others were made in Berkeley. For the numbering, I simply use a number every time I am performing a ligation. It makes retracing the various plasmids easier through fridges/freezers or in the lab book. So yeah, plasmid #705-1 was the 705th ligation I did in Berkeley ! I also use the numbering system to make sure that any modification made to a vector cannot be confused with an earlier version: it will have a totally different number. I keep these numbers so each plasmid can be retraced to a specific miniprep/glycerol tube that was made during the original cloning.

 

Q2: There are other Gateway compatible vectors available through different sources. How can I know which vectors are compatible with the ones described on this site ?

A: For other Entry vectors to be compatible with our system:

Selection: everything except ampicillin.

att sites: att L1 and att L2.

 

For other Destination vectors to be compatible with our system:

Selection: everything except kanamycin.

att sites: att R1 and att R2.

 

Q3: I am having trouble with the lentiviral Destination vectors. When I grow them, I get either nothing or a vector that is the wrong size. Why ?

A: First, make sure you are propagating the lentiviral Destination vector in the DB3.1 or ccDB survival strain under both chloramphinecol and ampicillin selection (except for the pLenti X1 Zeo, pLenti X2 Zeo and pLenti CMV/TO Zeo Destination vectors which use zeocin instead of ampicillin). The Destination vectors contain the ccDB gene, which is toxic for most E.coli strains. If the Destination vector is propagated in a strain such as DH1alpha, the few colonies that might grow will have lost the ccDB gene from the plasmid, most likely through recombination.

Second, never inoculate too much of the glycerol stock or grow the cultures for too long (i.e. >20 hours). These plasmids are fairly large and can have a tendency to recombine. After extended period in cultures, the antibiotic selection is weakened and bacteria that have lost the plasmid will grow faster and slowly take over the culture. Sometimes, re-transforming the Destination vector into competent DB3.1 cells will be more rapid. It is normal to obtain small colonies andcultures that grow slowly. In my experience, a too dense culture normally indicates that the plasmid has been lost. The same is sometimes also true for Destination vectors that have been recombined with Entry vectors and are growing in the Stbl3 strain, even though this strain is better to prevent recombinations.

 

Q4: How long can I keep my viral supernatant ?

A1: Frozen (-80oc) supernatants. We were able to efficiently transduce HeLa cells with supernatants that were frozen for 3 years and 8 months. The efficiency was quite acceptable, but we did not re-titer them to compare with the original frozen stock. Also, the supernatants were never thawed before the day of the transduction.

A2: Non-frozen (4oC) supernatants. Normally, we can keep viral supernants for 2-3 months at 4oC with quite good transduction efficiencies. However, we did not compare their titers with the original stock to measure if there was a decrease in viral titers.

Please keep in mind that these are the results we typically get with our transfection procedure and that different settings might yield quite different results. Also, we noticed that repeated freezing/thawing was more damagable for larger viruses (i.e. with cDNAs >3.5 kb) than for other viruses. Different companies/web sites mention a drop between 10-50% in viral titers upon freezing/thawing of the viral stocks.

 

Q5: I don't see my overexpressed protein ! What's wrong ?

A1: Verify the Entry vector by sequencing to make sure no mistakes were made in the cloning step. Also, make sure that the LR recombination worked as expected.

A2: The pENTR4 vector contains an Nco I site (CCATGG) where the ATG can be used for translation initiation. I normally avoid using the pENTR4 vector unless I want to use the ATG from the Nco I site for translation initiation.

A3: If the protein to be overexpressed is really toxic to the cell, it is possible that the promoter might get rapidly inactivated, normally through methylation. Analyze the 293T cells after transfection and collection of the virus to see if you can detect your protein. Since these cells contain live viruses, I normally use the protocol to generate whole cell extracts described here. The pellet is resuspended in a solution containing SDS and boiled for 5 minutes to inactivate viruses and proteases that might degrade the protein of interest.

A4: Use a control protein to make sure the viral production, transduction and Western blot analysis is working correctly. Vectors encoding GFP, Firefly luciferase (tagged with V5 or untagged) were sent to Addgene. Look at the control vectors page (here) for more details.

 

Q6: How can I sequence my vector after the LR recombination ?

A: I normally don't sequence my vectors after the recombination because the recombination should not affect the sequence between the attL1 and attL2 site. I confirm each clone by restriction digest, using either Eco RV or Nco I which cut several times the vector backbone. In my experience, a faulty LR recombination will give rise to gross rearrangements that can easily be detected by restriction digest. However, in the case of a troublesome sequence for E.coli, you can use a primer in the promoter of the Destination vector (CMVforw, PGK, H1, U6, EF1alpha) and a reverse primer from the attB2 site.

 

Q7: Should I remove the poly adenylation signal (poly A) from my cDNA ?

A: YES. Retroviruses and Lentiviruses have an RNA genome and the presence of a poly A will interfere with viral replication. The Woodchuck post-transcriptional element (WPRE) improves the stability of the mRNA and compensates for the lack of poly A. One group (Hager et al. 2008) has reported improved transgene expression with the insertion of a poly A signal, but with significantly lower viral titers.

 

Q8: What is the sequence of the primers used for sequencing the vectors ?

A:All primer sequences are given 5' to 3':

CMVforw: CGCAAATGGGCGGTAGGCGTG

CMVtightFORW: GGCCTATATAAGCAGAGCTCG

EF1-a: TCAAGCCTCAGACAGTGGTTC

EGFP-C: CATGGTCCTGCTGGAGTTCGTG (3' end of EGFP, forward primer)

EGFP-N: CGTCGCCGTCCAGCTCGACCAG (5' end of EGFP, reverse primer)

ENTRforw: GCTCGGGCCCCAAATAATGA

ENTRrev: CACGGGCCAGAGCTGCAGCTGGATGGCA

H1:TCGCTATGTGTTCTGGGAAA (for sequencing shRNAs derived from the pSUPER or pTER plasmids).

human PGKforw: GTAGTGTGGGCCCTGTTCCTGCC (not compatible with the mouse PGK promoter).

human U6: GACTATCATATGCTTACCGT (for sequencing pSM2(U6)-derived clones).

Luc-f: AGTCAAGTAACAACCGCGA (3' end of luciferase, forward primer, for sequencing miRNAs inserted after LUC).

pGEX5': GGGCTGGCAAGCCACGTTTGGTG (3' end of glutathione-S-transferase, forward primer).

T7: TAATACGACTCACTATAGGG (for sequencing 5' end of cDNAs under the control of the EF-1a promoter).

V5 reverse: ACCGAGGAGAGGGTTAGGGAT (for sequencing 3'end of cDNAs under the control of the EF-1a promoter).

WPRE reverse: CATAGCGTAAAAGGAGCAACA (5' end of WPRE, reverse primer, for sequencing 3' end of cDNA).

A more complete list of sequencing primers can be found on Addgene's web site:

http://www.addgene.org/pgvec1?f=c&cmd=showfile&file=primers


 


www.000webhost.com